I will post a decode so that you have someone to respond to.
I couldn't find a start or stop codon so I wasn't sure where to start the decode. I had to begin from the first base, so the sentence doesn't make sense.
DNA: ATGGTGCATTTTACGTTAGTGCAATATACT RNA: UAC CAC GUA AAA UGC AAU CAC GUU AUA UGA From think(ing) you delirium after animals thinking I time it
Can you tell me what the sentence should have said?
Okay, but compare the RNA you have just posted with the RNA in my comment. It doesn't match at all, so the question is, how did you get that RNA from your DNA?
Another clue is that there are not start/stop codons visible in your DNA. Start/stop codons will look like "TAC" and "ATC" respectively. There aren't there.
I think I do see what might have happened. If you take your DNA and change all of the thymines (T) to uracils (U), you get the RNA you list in the comment, but that isn't how you do a reverse transcription. ALL of the bases need to be reverse transcribed, not just the thymines. Take a look at my comment above and follow the base changes going from DNA to RNA.
Given your RNA, here is what your DNA should have looked like (and the stop codon is "UAG"):
I will post a decode so that you have someone to respond to.
ReplyDeleteI couldn't find a start or stop codon so I wasn't sure where to start the decode. I had to begin from the first base, so the sentence doesn't make sense.
DNA: ATGGTGCATTTTACGTTAGTGCAATATACT
RNA: UAC CAC GUA AAA UGC AAU CAC GUU AUA UGA
From think(ing) you delirium after animals thinking I time it
Can you tell me what the sentence should have said?
This comment has been removed by the author.
ReplyDeleteIt is supposed to say We sleep in school because we dream of pizza. This is the RNA code:AUG GUGCAUUUUACGUUAGUGCAAUAU ACU
ReplyDeleteOkay, but compare the RNA you have just posted with the RNA in my comment. It doesn't match at all, so the question is, how did you get that RNA from your DNA?
ReplyDeleteAnother clue is that there are not start/stop codons visible in your DNA. Start/stop codons will look like "TAC" and "ATC" respectively. There aren't there.
I think I do see what might have happened. If you take your DNA and change all of the thymines (T) to uracils (U), you get the RNA you list in the comment, but that isn't how you do a reverse transcription. ALL of the bases need to be reverse transcribed, not just the thymines. Take a look at my comment above and follow the base changes going from DNA to RNA.
Given your RNA, here is what your DNA should have looked like (and the stop codon is "UAG"):
RNA: AUGGUGCAUUUUACGUUAGUGCAAUAUUAG
DNA: TACCACGTAAAATGCAATCACGTTATAATC