DNA Code

ATGGTGCATTTTACGTTAGTGCAATATACT

• With the help of Thomas Malthus
• The person that I feel that had the most influence on Charles Darwin was Thomas Malthus. Thomas Malthus was a positive influence on Darwin. Malthus' essay, "On the Principle of Population", inspired both Charles Darwin and Alfred Russel Wallace, but Thomas Malthus was not interested in species change. Instead, he pointed out that population in nature is determined by the amount of resources there are available. There is always constant competition for  resources which affect the population.
• Thomas Malthus observed that in nature, that plants and animals produce far more offspring than can survive and that man too, is capable of over producing if left unchecked. He then realized that producing more offspring then can survive establishes a competitive environment among the siblings and the variation they may produce might have a slightly greater chance of survival. http://www.ucmp.berkeley.edu/history/malthus.html
• Darwin built upon the ideas of Thomas Malthus. Charles Darwin and Thomas Malthus both reached the conclusion of the basic mechanics of the evolutionary process. Thomas Malthus suggested for a lower number of family members to combat the natural resources from disappearing. Charles Darwin and Thomas Malthus both spread their ideas through nature and people.
• Charles Darwin had some of his theory of evolution, but the missing pieces were filled in by Thomas Malthus. I don't think Charles Darwin could have done it by himself. After he read the "Essay on the Principle of Population", he was more clear about his idea of natural selection.
• Before Darwin was going to publish "On the origins of Species", Wallace sent Darwin a paper with the similar idea that he described evolution as a process driven by competition and natural selection. The church had a negative attitude towards his book. The church thought that if evolution is true, there is no God and some even thought that he was trying to turn people away from God.