Human Variation & Race

1. High levels of Solar Radiation can cause skin cancers, sunburns and cataracts can develop in the eyes if there is a prolonged exposure.

2.

• A short term solution can be to get out of the sun and avoid it if possible. Go inside a building and you can even apply sunscreen to block the solar rays from the sun. 
• A humans Facilitative adaptation to the skin is the ability for a lighter skinned person to tan. Longer exposure to the Sun's UV rays allows our skin to change color and turn darker due to Melanin. There are different types of Melanin and people with light complexioned skin usually produce Pheomelanin. Melanin acts as a protective biological shield against UV radiation. 
• An example of a developmental adaptation to solar radiation is that dark skin people pass down their dark skin from generation to generation. This development has helped the generation have better protection from the sun and solar radiation. The DNA of the generation has changed due to this development. 
• An example of a cultural adaptation would be that a culture might wear certain clothing, like a hat to protect them if they have little or no hair. In some cultures, people use sunscreens and certain materials that help to block most of the radiation from the skin. 

3.The benefits of studying human variation this way is that we can get a peek of how different cultures use various methods to do certain things like protect themselves from solar radiation. The information we obtain from other cultures can help to give us a better understanding of how they act and perform tasks.

4. I would use race to mark the differences in all cultures. Not all cultures are the same and therefore, we can get new information from them which might help us in a way. The study of environmental influences on adaptations is a better way to understand human variation than race because a cultures practices are usually passed down from generation and a different culture might look at it differently because that culture doesn't do it. Discrimination based on race is a easy thing to do and it doesn't matter what race a person may be, as long as they are all exposed to the same conditions to realize the difference they make to protect from it.

Language Experiment

Part 1. At the beginning of the first part where I couldn't use any hand signals or talking, was difficult. My partner that was conversing with me was a little puzzled on why I was doing this. They then asked more questions that were a yes or no answer. If the person that was speaking to me was in a different culture, I think they would have a greater advantage in communicating more complex scenarios because of the use of hand signals, noises, or other gestures. The speaking culture might find it harder to decipherer the culture that doesn't use symbolic language.

Part 2. I could not go the full 15 minutes without using any embellishments. The thing that made it difficult for this experiment was my use of hand signals when I was speaking. If I wanted to tell someone a location of an object, I would often point or make a gesture of where it was. My partner that I was speaking to usually told me to repeat the question again that I previously asked and thats when I used my hand signals to help them better understand. The non-speach language that we use basically everyday can help us better explain what we are trying to say and can also help the person on the other side of your conversation have a better understanding also. There can be people that have difficulty reading body language but if you are very expressive of it, everyone should be able to somewhat get an understanding of what you were trying to communicate. I don't think there would be any benefit of not reading body language.

Charles Dawson and the Hoax.

1. Charles Dawson was digging in a gravel pit and claimed to find the remains of an ancient human skull in the town of Piltdown, England. The Scientists used the measure of fluorine content in fossils to roughly date how old the fossil was. They concluded that the fossil was actually relatively young. The artifacts were stained and the teeth had been scratched down.

2. The human faults that came into play was that the people involved with this hoax wanted fame and attention. England wanted fame in finding a human skull and participate in the scientific community.

3. The positive aspects in revealing the skull was the use of  fluorine to determine the approximate age and then the advances such as using radiocarbon dating.

4. I don't think it is possible to remove the human factor from science because the human factor provides information to other people such as new theories and concepts. People can't be replaced by other things because there might not be varied speculations.

5. The life lesson is that to never take something as true or correct from an untrusted or unverified source.

Dentition Patterns Of Primates

Lemurs (Prosimians/Strepsirhini)

A. Lemurs inhabit Madagascar and can also be found on the Comoro islands. Madagascar is a sub-tropical island with a wet season. Monsoons bring storms and cyclones to the East and North from December to March. The dry season lasts from April to October. The mountains are warm and thundery from November to April. Most favor sources of food from trees and plants, some specific species of Lemur are omnivorous 

B. Lemurs have a dentition trait called a dental comb, which looks like a comb and is made of forward-projecting incisors and canines. They use the dental comb to comb the fur of others.

C. Lemurs are usually found in trees and forests, most are herbivores although, some can eat larvae or even larger organisms such as frogs. Their dental combs have a link between their diet, which consists of small fruits and insects. Lemurs have pointy premolars which help to consume their meal. 

Spider Monkey(New World Monkey/Platyrrhini)

A. Spider monkeys can be found in Central and South America in the tropical rain forests. They inhabit most of the upper layer of the rain forests. They are social animals that prefer undisturbed primary rain forests. 

B. The diet of Spider Monkeys mostly consists of fruits and nuts. If food sources are scarce, they turn to   insects, birds's eggs, tree bark, and even honey.

C. Spider Monkeys are arboreal, or living in trees, their diet above helped to shape the way their teeth are. 

Baboon(Old World Monkey/Cercopithecidae)

A. Baboons live in  Africa and Arabia. Most prefer semi-arid habitats, but some live in tropical rain forests.

B. Baboons are omnivores and mostly feed on fruits, grasses, seeds, bark, and sometimes have a taste for meat. They will consume birds, rodents, and even Antelopes.

C. Although baboons mostly consume seeds, grasses, and fruits, they have large canine teeth and flat molars because they don't eat meat as much as they do the other. 

Gibbon(Lesser Ape/Hylobatidae)

A. Gibbons can be found in tropical and subtropical rain forests from Northeast India to Indonesia, China, Borneo and Java. 

B. Gibbons are omnivores and eat fruit, flowers, and tender plant shoots. Spend almost no time on the ground and always look for food in the trees. 

C. Like other omnivore primates, Gibbons have molars that are more flat than those found in herbivores. 

Chimpanzee(Great Ape/Hominade)

A. Chimpanzees are found in the African rain forests, grasslands, and woodlands. They use tools, walk upright and can perform complicated tasks. 

B. Chimpanzees are omnivores and eat plants and fruits like the other primates. They can have a different diet than other primates because they occupy different regions. 

C. Because chimpanzees occupy different regions, their dentition allows them to have a varied diet. 

From the research that I have done, I can conclude that the environment and behavioral influences on these primates has an effect on the way their dentitions are formed. The structure of their teeth are different and have been adapted for different diets due to their living conditions and environment. They almost have the same dentition form but have adapted minor varieties for each one. 

Homologous and Analogous

Homologous Trait.

The tailbone of a human is analogous to the structure of the beginning of many animals' tail's, such as monkeys. 

The function of the tailbone in humans is to connect ligaments, muscles, and tendons. The function of the tailbone in monkeys is to attach their tail which they use to swing from trees and to do other various activities. Some people say that the tailbone in humans is vestigial, but not entirely useless.

The common ancestor for these two could be a monkey, but when someone says that, they think of one with a tail. The ancestor could have been more of an ape, bonobo, or gorilla, but the common ancestor is extinct.

Analogous Trait.

The Analogous trait that I found is shared between a fish and a penguin which is a fin. The fins on both of these animals help them navigate their aquatic environment. The fins on the fish help it swim. Both of these animals inhibited these adaptations from the environment, rather than a common ancestor. The common ancestor of a penguin is a pheasant.

DNA Code

ATGGTGCATTTTACGTTAGTGCAATATACT

• With the help of Thomas Malthus
• The person that I feel that had the most influence on Charles Darwin was Thomas Malthus. Thomas Malthus was a positive influence on Darwin. Malthus' essay, "On the Principle of Population", inspired both Charles Darwin and Alfred Russel Wallace, but Thomas Malthus was not interested in species change. Instead, he pointed out that population in nature is determined by the amount of resources there are available. There is always constant competition for  resources which affect the population.
• Thomas Malthus observed that in nature, that plants and animals produce far more offspring than can survive and that man too, is capable of over producing if left unchecked. He then realized that producing more offspring then can survive establishes a competitive environment among the siblings and the variation they may produce might have a slightly greater chance of survival. http://www.ucmp.berkeley.edu/history/malthus.html
• Darwin built upon the ideas of Thomas Malthus. Charles Darwin and Thomas Malthus both reached the conclusion of the basic mechanics of the evolutionary process. Thomas Malthus suggested for a lower number of family members to combat the natural resources from disappearing. Charles Darwin and Thomas Malthus both spread their ideas through nature and people.
• Charles Darwin had some of his theory of evolution, but the missing pieces were filled in by Thomas Malthus. I don't think Charles Darwin could have done it by himself. After he read the "Essay on the Principle of Population", he was more clear about his idea of natural selection.
• Before Darwin was going to publish "On the origins of Species", Wallace sent Darwin a paper with the similar idea that he described evolution as a process driven by competition and natural selection. The church had a negative attitude towards his book. The church thought that if evolution is true, there is no God and some even thought that he was trying to turn people away from God.